It is very technical, so the easy conclusion comes first:
Each human is an animal bio-computer BUT with an immortal soul. Instead of bits (zeros and ones), animals are wet programs based on four letters (A, G, C, T).
I really recommend this article to fully grasp the bio-computer/soul analogy:
Biochemists and micro-biologists have become rookie bio-programmers using parts (sequences) from different viruses, like a computer programmer reuses instructions, algorithms, binary files and libraries, coded by prior programmers.
Unlike computers, which we built from scratch and have the detailed blueprints and know how they should work, lifeforms didn’t come with the Creator’s manual: we have the job to figure it out, reverse-engineering one word at a time.
The problem is that they are still clueless about many essential processes of the bio-computer, a bio-machine organized like a clock, so amazingly intertwined that, after 8 years of full-time med-school, a physician barely understands it.
Yet, there’s a big difference. If a progammer makes a mistake, he corrects it, and reiterates the process (re-run, reboot): no harm done.
The bio-programmers can’t even correct a botched gene-therapy: genes are altered for ever. If a bio-programmer makes a mistake, it could lead to a fatal error, not a blue frozen screen, not a bricked rooted phone, but human deaths. You can’t re-start a bricked human!
Even worse: if the coding mistake gets in the seminal cells, they are passed into future generations, not just that family tree, but eventually the whole human gene pool, since there’s currently no natural selection in humans.
SV40 is a dangerous carcingenic virus. There’s no prudence in hacking humans with SV40 sequences they don’t fully understand. They are pride monsters believing they are gods.
Nobody seems to be standing in their way, even if they deliberately make bio-weapons (bio-malware)!
To understand the context, jump to the bottom of this:
--------------
New England Journal of Medicine study confirmed that viral promoter with SV40 sequence caused cancer: gene-therapy Skysona (eli-cel), caused blood cancer (e.g. leukemia) in 10% of patients 1, possibly more, since “more patients may appear over time” 2.
The drug had been 2022 FDA fast-track approved with a black box warning for the cancer “side effect”: in 2021 the FDA had put a clinical hold on eli-cel trials after the company, Bluebird Bio, found that the treatment caused a cancer-like condition in one patient, while two other patients were also being monitored for similar symptoms.3
“Stem cells are isolated and modified by using a lentiviral vector to add the ABCD1 gene4. The stem cells in bone marrow are killed with chemotherapy, and replaced with the modified stem cells.
Cause of cancer: Multiple off-target insertions, different ones for different people. Eli-cel causes cancer because it is:
- specifically done to stem cells, which are closer to cancer than usual
- applied to cells away from the immune system, which can often detect infections and kill infected cells early.” 5
The cases of cancer may have been driven by the design of the lentiviral vector used in Skysona: “using a lentivirus to insert a functioning form of the ABCD1 gene”: “a risk of that type of promoter (MNDU3) is oncogenesis, or driving the development of cancer, Duncan [lead author] explained” 6 The promoter plasmid7 has:
• SV40 ori: “The SV40 origin of replication comprises a run of thymine and adenine residues. Integrity of this AT-rich sequence is known to be essential for replication.” 8 “... interactions of simian virus 40 (SV40) large tumor antigen (large T) with the control region of the SV40 genome” 9 … “The simian virus 40 T tumor antigen (SVLT) induces replication of plasmids bearing the SV40 origin of replication (SV40 ori) within mammalian cells.” 10
• EBV Reverse, GTGGTTTGTCCAAACTCATC (Invitrogen), SV40 polyA terminator, reverse primer
• SV40 poly(A) signal, for “improved transcript life”11 “eliminated the inhibition induced by Alu14”12
• SV40pA-R, GAAATTTGTGATGCTATTGC, reverse primer SV40 polyA a “tool for accurate control of the relative expression levels of multiple genes. It has wide-ranging applications in fields related to the study of biosynthesis of multi-subunit proteins, proteomic research on protein interactions, and multi-gene metabolic engineering” 13 and directed evolution14.
• HIV-1 Ψ (psi) 15 for translation inhibition of HIV-1 full length mRNA.16
President John Quincy Adams: “Masonry ought forever to be abolished. It is wrong - essentially wrong - a seed of evil, which can never produce any good.”
If you are a mason or know a mason, ask him to ask his 33° master to put in writing and sign it, that Lucifere is not "the great architect" (then who?). If he refuses, then he’ll know he is serving Satan: tell him to get out of masonry NOW.
Almost all anti-viral vaccines and all COVID vaccines were abortion-linked (using cell lines from aborted babies, i.e. butchered-alive delivered babies). Abortion is one type of ritual murder: Satan’s most wanted human sacrifice. Abortion-laced vaccines have the same effect of hexxed food: sharing in the Satanic chalice of blood, just the same as when they drink the blood of their children/virgin/human victims in their ritual murders.
He still props up germ theory and vaccinology. These intentionally overcomplicated topics distract people from rejecting the entire false paradigm of vaccinology. Pharma fascism continues.
I am not at all surprised - or disturbed by these revelations.
Why Don’t They Discourage Bad Dietary Choices and Stop Vaccinating?
Consider the impacts on the economy of not reducing the life spans of humans.
Let’s say 30% of the population of a country lived beyond 90 years. Pension plans would implode as there would not be enough money to cover redemptions. For those on public pensions, we could raise taxes to ensure pensioners get paid, but that would mean less money for schools, roads and other infrastructure. Government services would need to be dramatically scaled back resulting in huge job losses.
All of these elderly people would essentially be ‘useless eaters’ sapping the economic strength of the country to provide them with medical care and free bus passes, while they produce and contribute nothing.
Why did they ramp up the vaccine schedule in the 80’s? I would suggest that they did this because population (which grows exponentially) was about to get out of control so they needed to take action. What would our overall population be if not for the vaccine push and the dramatic increase in the availability of processed foods in recent decades?
You are Expendable
At the end of the day all they care about is having enough circus and barnyard animals to operate the farm. They could care less about you or your health - you are EXPENDABLE.
They most certainly do not want one third of the population living to 90+ Japan and China are prime examples of what happens when a country is top heavy on elderly citizens. Too few young people to support the elderly.
Without these wise decisions by the Men Who Run the World to deploy strategies to cull the herd, the global economy would have collapsed years ago under the dead weight of too many geriatrics.
Polio vaccination in India is a sorry tale with or without contamination. The classic vaccine industry playbook:
1) pre-vaccine, draw the definition of the disease as widely as possible to bump up the apparent threat
2) introduce vaccine and redefine the problem much more narrowly to exclude many or most instances that would previously have been counted as the disease
3) establish a new category of disease to capture vaccinated individuals who stubbornly continue to show the symptoms of the original disease or any new symptoms that might arise.
Hey presto, polio is cured by vaccines.
In the case of polio in India (where the guinea-pigs got up to 10 separate shots), they call the new category non polio acute flaccid paralysis. It just happens to have the same symptoms as polio acute flaccid paralysis, but obviously can’t be because…… well, vaccines of course have eradicated the polio version.
And the Indian government let it go because of the other inducements given by the various aid agencies, WHO etc. It’s beyond wicked.
All you need to know is that all vaccines are bullshit. If we just got people to that point, we wouldn’t have to sit here and speculate on which poisons are in which vials.
Hi Doctor! I would like to send your piece regarding the discovery of undeclared 'contamination of injections (plasmids) found in mRNA Covid injections' to my local medical centre with whom I'm having a running dispute regarding my repetitive updates on the dangers of poisonous, unsafe, unproven 'experimental' injections known as 'mRNA Vaccines'.
They have warned me off so I now send just one email each week with three important topics for them to realise the inherent dangers of mRNA injections and of what has been going on since the Covid jabs were introduced back in 2020.
Could I suggest that you are wasting your time? You might be better setting up a stall outside the practice with a bunch of papers that show what you are trying to show. People would be very interested. Look up Steven Crowder.
I understand your suggestion that I might be 'banging my head on a brick wall', but at 79, I'm not easily able to get involved in such activities. My hope is that some of the many recipients I copy in on these important (hidden) emailed issues, there will be some of the medical staff who might have the inclination to be inquisitive. They will see that some of the suggestion could be true as they emanate from experts and professionals. I also copy in my local politicians, the media and other derivative organisations like the Vax Control Group, who have been recording and analysing vax related issues for over 3 years now.
Not only that, I feel better hoping that some of my emails might stimulate those with an enquiring mind. Even if it's only a 'receptionist' or 'clerk' working in the medical environment.
Nearly three years ago, I went for a preliminary hospital meeting to discuss a hip replacement with a nurse. I wore a tee-shirt with the message 'Covid Unvaxxed Club' on. The nurse was relieved to reveal that she did not want the jab and that her job was at risk for refusing it. So there are many who might be 'on the fence' or feeling alone in their belief that they are being unreasonable to refuse poisonous mRNA being jabbed into their bodies. It's my small token to let people know they are not alone and that it can be sensible to think outside the box!
We all have our own methods of expressing our beliefs. some of which might be a waste of time, but at least we feel better for making an effort to be heard!
Yup! 3 weeks after a hernia operation - in the same hospital, with whom I'm in dispute regarding my historic bombardment of emailed evidence regarding mRNA Vax Dangers, Big Pharma's insistence on Zero LIABILITY and other controversial matters.
Both ops went well, I wore my 'UK Covid Unvaxxed Club' tee-shirt during the hip op and a 'Don't mention IVERMECTIN" tee-shirt during the hernia operation. The medical staff seemed to accept my unreasonable thought processes without comment or criticism!
Since the operations, I find myself in conflict with both my local medical centre and the Hospital Administration, who I didn't realise were part of a Medical Group. I'm not sure they realise I've been a patient twice over the past 3 months, but I've got a physio appointment nest week when I'll make myself known to the Admin Dept to see if they want to discuss any of the FACTS and DATA that I've been sending, which they claim is 'unwanted'.
On the matter of other Hip operations with 'complications' I seem to have avoided such issues. The unfortunate lady that seems to have had her life altered by a Hip-op seems to have had a problem with a 'cobalt' type product. I can only imagine that cobalt isn't as durable as titanium and ceramic, which I am told is the type used on me. I just hope the hip stands up to me getting back into cage fighting. (Only kidding). Unjabbed Mick.
That's the problem! Coordinating our actions. I think we need a website to achieve this.
Can anyone help in this important issue? If we could access one site that shows what activities and events are taking place, what actions others are taking and the success of these actions, we can get recognition of the truth about what has become apparent since 2019.
Great topic Fast Eddie!
Unjabbed Mick (UK). Together we can win - divided we struggle for acceptance and acknowledgement!
"Jabs" is a great term for the administration of the pseudovaccines. I wonder if Deborah just said what she did to virtue signal but actually is voting for Trump. I wouldn't be surprised if she got her perspective from her husband who in turn picked it up from meetings of "White Dudes for Harris."
I agree about the term "jabs." I actually think I picked up its use from your "Against the Jab" profile motto and started using it quite a while ago rather than type out "injection." And because it seems to more precisely allude to the violence of pseudovaccination with a boxing metaphor.
Yes, I did! Wish I'd seen it live but I read a very detailed article (maybe in the NY Post?) that reported at least half a dozen or more very clever and pointed barbs against Harris and the Dems. I don't think anyone else could have delivered the same "jokes" with the same effect as Trump. It really is all in the delivery.
Deborah! Had you bothered to investigate you'd have realised by now that those of us who have studied what has been going on in the medical and pharmaceutical world, know that 'VACCINES' (Pre-2010) included attenuated material from the disease or virus it was supposed to counteract! Several years ago, 'they' (conveniently) changed the dictionary to suit mRNA DEADLY UNPROVEN JABS to be included in the meaning of VACCINE.
That's why the educated amongst us try to avoid using the word VACCINE for mRNA injections (JABS) which have been modified to suit Big Pharma's mercenary greed and voracity for control.
Unjabbed Mick (We'll live longer if we can avoid CORRUPT pharmaceutical murders.
I don't need to study anything to know that a jab is an intentionally derogatory term. Scientists don't use that term. So when you do, your message is less believable.
These vaccine manufacturers wouldn’t have a financial reason to CAUSE cancer recklessly or deliberately, would they? Such as some other, very expensive, products they might seek to sell cancer patients, would they? That would be a massive conflict of interest, which surely the - independent and certainly not conflicted - regulators would immediately spot and address, isn’t it?
Great article: clear, easy to follow and deeply disturbing.
It can be argued as to which motivation is primary, but I think that it would be more accurate to consider the points as short and long-term goals. Making scandalous profits on the way to cutting population levels and subverting the sanctity of human souls is a logical step.
WOW, just wow! Thank you for this brilliant yet frightening piece and reference materials. I will share with many, but sadly, if I share these things with my jabbed family and my sons, it will only drive a bigger wedge. They won't entertain anything contrary to the narrative they've been fed by the media. They will not even read something that might save their lives. I'm just a tin foil hat wearer, who spreads conspiracy theory. My 88yr old Mother just got her flu shot last week, she wouldn't listen to me. Surely the rest of my family will too. 😴😪 🙏🙏
I might as well try that. At this point they're already poisoned, and if they stop taking shots, because of me, and get sick, well... we know who will get blamed. Can't win for losing.
I work in healthcare and this reminded me of a patient we lost last week - a man loyally and fiercely loved by his devoted family who only wanted to look after him, but who deeply believed every word every doctor had ever spoken.
He died last week, having developed multiple large tumours - 2 in his chest (which the oncologist described as "beginning to split apart"), pressure on his heart and lungs making it difficult to breathe, another mass pressing on his bladder causing incontinence, and legs so heavy and swollen with oedema and fluid "soaking through bandages" that he was confined to a wheelchair.
This was such a miserable existence that he was in the process of initiating "Assisted Dying" pathways, but not before the family agreed to yet another procedure - an endoscopy which inadvertently perforated his bladder and killed him last week.
He'd gone from independent, fit and healthy, walking and cycling daily, and maintaining a large garden - to 17 different vaccinations in a 2 year period, and being loved to death.
GOD rest his soul, and have mercy on his family. So sad. GOD bless you, you will need great strength for the coming, most likely, monsoon of these types of occurrences.
Governments and regulatory bodies are providing a self service not a public service. One of the jobs they were charged with was to be gatekeepers between the population and predatory agencies to provide protection, instead they have offered us to them on a silver platter while receiving rewards for their treachery. We all heard the awful slogan Build Back Better during Covid well our governments, public health, regulatory bodies and institutions need to listen to their ow propaganda and be built back better. This article horrifies me and outstrips any fictional horror story I know of. Most of us are not free from these dangers, I did not take Covid injections but I received others pre 2020.
"Governments and regulatory bodies are providing a self service not a public service. One of the jobs they were charged with was to be gatekeepers between the population and predatory agencies to provide protection, instead they have offered us to them on a silver platter while receiving rewards for their treachery"
Giving a vaccine against a virus that is only transmitted sexually or IV drug use to a baby asks a lot of questions of the people looking after the baby
U may find this interesting, as a gyn , I had a patient with high grade Vain (she had hysterectomy yrs ago and has vaginal warts , age 61) . Sent her to a gyn onc who asked me to give her a rx for guardasil shot at the local cvs. I was dumbfounded and said no .
As a mother who didn't do the proper research and allowed her children to be vaccinated against HepB, reading that comment makes my heart ache and brings tears to my eyes. I appreciate this brilliant work that you have shared. Thankfully, I found Dr. David Martin and Dr. Judy Mikovits early in the pandemic, have been keeping up w/ the work of Kevin McKernan, and listen to podcasts w/ Dr. Jack Kruse. When my children were born, I (unfortunately) blindly trusted the pediatrician. Deferred Hep B and other shots for second child at birth, then did what I was told was safe and effective: took her for her well visit at 2 months where she received five shots(!), one which was Hep B. After that visit, she developed an unknown (this is not eczema! said the pediatrician) autoimmune skin condition. I count my blessings that I found a holistic nutritionist who used applied kinesiology to work with my daughter at 6 months; I was giving her fish oil and probiotics from that point forward. I continued with the "schedule" for 16 more months, then after she had a reaction to the DTaP at 18 mo, I finally woke up. Six months later, we moved and saw the head pediatric dermatologist at Hopkins - he told me he sees this everyday (!), slapped a label on it, and told me she'd need to take an antihistamine for the next 10 years, that I just needed to find the dose that didn't make her dopey. I promptly found an integrative physician and we found another way (quercetin!) and we have been on a journey ever since. Her life has been full of health challenges and after reading all the vaccine package inserts, especially what appears in the post marketing adverse events section, I am pretty confident the root cause of many of the things she faces is the shots. I realize the damage could have been far worse, as she does not have autism and wishes to pursue a career in medicine. In fall of 2020, I was researching excipients and adjuvants, looking at the CDC's tables, pondering the impact of these chemicals and especially curious about the HEK293 cells. I knew about aluminum and Dr. Exley's lab. And now I know more, thanks to your work. It's so much to take in, especially for one who did not study medicine. I recently heard Dr. Jack Kruse say "wounds create your wisdom" -because of her wounds, we knew not to get anywhere near the covid shots. Thank you for this important information.
They can test mothers prior to delivery so there is really no excuse but the one they give is that hepatitis b could be acquired through close household or daycare contacts-blood, fecal exposure, using or chewing on an infected person’s toothbrush. I would like to know of the documented cases of any of these things that have happened. Have read that after a few years the immunity is gone unlike when it is given later. I know mine was still showing up in blood work more than 20 years after I had hepatitis b vaccine when working at a clinic. It is insanity to inject all newborns with anything I took no medication of any sort during my pregnancies. Why would I want my child immediately assaulted with something unnecessary for almost a hundred percent of American infants
Exactly. If the mother is negative then the family is negative and you don’t get hepatitis B from toothbrushes. And, not wanting to state the obvious but babies don’t actually have teeth.
This does need calling out. If someone wants to give your newborn baby a hepatitis B vaccine, ask why. If they say that they can get hepatitis B in the hospital, get out of that hospital.
Just had another friend drop dead yesterday... turbo stomach and lung cancer... less than 6 months from first symptoms to death. And during that time he was pumped full of chemo so suffered horribly
So sad. An aquaintance of mine, who still thinks the shots are great and continues to get boosters, said the other day she knows 6 people (in her small rural town) with pancreatic cancer ... 6! I thought it used to be pretty rare, but not nowadays.
Arkmedic—when a Substack article shows up in my inbox from you i know its going to blow my mind. You never disappoint.
The problem is still this though—the media will ignore this new info, they will mock anyone talking about it and in 6 months the covid vaccines will still be on the childhood schedule.
Wow. I think I might invest in that company. Sounds reaalllllyyyy profitable. So despicable how these companies with profit from the diseases they create.
That fcuk-wit that used to be head of the TGA (as well as everyone else that worked there) has a bit of explaining to do ... before all of his assets are confiscated to help pay restitution.
Thank you for this article and for tieing ask this data together. Fascinating stuff and I really hope the work you are doing receives the exposure it deserves. Do you know Dr Christopher Exley? He has been investigating the role of aluminium as as adjudicant in vaccines for several years. It's his life work I think. He's on Substack.
The thing that hit me, decades ago, when I first dug into the "science" and language surrounding those toxic injections labeled "vaccines," (which almost killed my four year old little girl, back in 1999,) was the oh-so-innocent sounding term "adjuvant." "Nice name you have there, what does it mean, actually?"
Well, something added to a vaccine to make it work better! What kind of something? How DOES it "help the vaccine to work better?!" And, guess what? Killed virus vaccines don't work without them. Hmm.
So, in my experience, adjuvant is a "cover label" for TOXIN. Something stunningly toxic in fact, that gets injected with the killed virus to shock the immune system into making antibodies against a dead viral particle, which otherwise it will not do. It's an assault on the human immune system that in my lay person's terms, gives many children's immune systems "PTSD" in the form of allergies, asthma, autoimmunity, etc., and the inflammation from the injection of these poisons does long term brain damage as well, in many cases.
But, here is the point now, after this recent discovery that these adjuvants are not simply highly toxic substances but actual transfection devices destroying cellular integrity & driving Foriegn genetic material into our cells which then can "hack" or possible combine with our DNA.
Wowsa. Now I know why so many of my female friends never fully recovered post Gardasil. It not just the toxin it's the DNA damage, and why so many women in the USA are infertile, why cancer is skyrocketing, why Autoimmunity of all sorts, and intellectual disabilities are soaring. Why we are the sickest industrialized nation on Earth.
Arkmedic, Humanity is under attack. Behind this very nefarious agenda is an evil intelligence which must thrive on human pain and suffering. I can come to no other conclusion, after witnessing the toxic injectable assault on all of America's children, especially since the 1980s.
Everyone must face this eventually, imho, who is seeking the truth here. We are being GMOed, and not to make us better, but to make us sicker, dumber & infertile.
To turn us into slaves in fact, unable to resist the yoke or to fight back, stripped of our Freedoms & our Property, as well as our Health.
It's time to reject all toxic or genetic shots, to go after ALL of the perps on fraud, murder, RICO, & more. The public & it's honest representatives must wake up & take this on as some brave Australians have just done. Push more, push harder, and never give up!
"To the winner go the spoils," & in this case the "spoils" are simply LIFE.
God gave it to us, so let no man, woman or "devil" steal it from us, yes?!
brilliant, thank you Arkmedic
I was about to publish on SV40:
It is very technical, so the easy conclusion comes first:
Each human is an animal bio-computer BUT with an immortal soul. Instead of bits (zeros and ones), animals are wet programs based on four letters (A, G, C, T).
I really recommend this article to fully grasp the bio-computer/soul analogy:
https://www.catholic365.com/article/26130/dog-beats-artificial-intelligence.html
Biochemists and micro-biologists have become rookie bio-programmers using parts (sequences) from different viruses, like a computer programmer reuses instructions, algorithms, binary files and libraries, coded by prior programmers.
Unlike computers, which we built from scratch and have the detailed blueprints and know how they should work, lifeforms didn’t come with the Creator’s manual: we have the job to figure it out, reverse-engineering one word at a time.
The problem is that they are still clueless about many essential processes of the bio-computer, a bio-machine organized like a clock, so amazingly intertwined that, after 8 years of full-time med-school, a physician barely understands it.
Yet, there’s a big difference. If a progammer makes a mistake, he corrects it, and reiterates the process (re-run, reboot): no harm done.
The bio-programmers can’t even correct a botched gene-therapy: genes are altered for ever. If a bio-programmer makes a mistake, it could lead to a fatal error, not a blue frozen screen, not a bricked rooted phone, but human deaths. You can’t re-start a bricked human!
Even worse: if the coding mistake gets in the seminal cells, they are passed into future generations, not just that family tree, but eventually the whole human gene pool, since there’s currently no natural selection in humans.
SV40 is a dangerous carcingenic virus. There’s no prudence in hacking humans with SV40 sequences they don’t fully understand. They are pride monsters believing they are gods.
Nobody seems to be standing in their way, even if they deliberately make bio-weapons (bio-malware)!
To understand the context, jump to the bottom of this:
--------------
New England Journal of Medicine study confirmed that viral promoter with SV40 sequence caused cancer: gene-therapy Skysona (eli-cel), caused blood cancer (e.g. leukemia) in 10% of patients 1, possibly more, since “more patients may appear over time” 2.
The drug had been 2022 FDA fast-track approved with a black box warning for the cancer “side effect”: in 2021 the FDA had put a clinical hold on eli-cel trials after the company, Bluebird Bio, found that the treatment caused a cancer-like condition in one patient, while two other patients were also being monitored for similar symptoms.3
“Stem cells are isolated and modified by using a lentiviral vector to add the ABCD1 gene4. The stem cells in bone marrow are killed with chemotherapy, and replaced with the modified stem cells.
Cause of cancer: Multiple off-target insertions, different ones for different people. Eli-cel causes cancer because it is:
- specifically done to stem cells, which are closer to cancer than usual
- applied to cells away from the immune system, which can often detect infections and kill infected cells early.” 5
The cases of cancer may have been driven by the design of the lentiviral vector used in Skysona: “using a lentivirus to insert a functioning form of the ABCD1 gene”: “a risk of that type of promoter (MNDU3) is oncogenesis, or driving the development of cancer, Duncan [lead author] explained” 6 The promoter plasmid7 has:
• SV40 ori: “The SV40 origin of replication comprises a run of thymine and adenine residues. Integrity of this AT-rich sequence is known to be essential for replication.” 8 “... interactions of simian virus 40 (SV40) large tumor antigen (large T) with the control region of the SV40 genome” 9 … “The simian virus 40 T tumor antigen (SVLT) induces replication of plasmids bearing the SV40 origin of replication (SV40 ori) within mammalian cells.” 10
• EBV Reverse, GTGGTTTGTCCAAACTCATC (Invitrogen), SV40 polyA terminator, reverse primer
• SV40 poly(A) signal, for “improved transcript life”11 “eliminated the inhibition induced by Alu14”12
• SV40pA-R, GAAATTTGTGATGCTATTGC, reverse primer SV40 polyA a “tool for accurate control of the relative expression levels of multiple genes. It has wide-ranging applications in fields related to the study of biosynthesis of multi-subunit proteins, proteomic research on protein interactions, and multi-gene metabolic engineering” 13 and directed evolution14.
• HIV-1 Ψ (psi) 15 for translation inhibition of HIV-1 full length mRNA.16
https://www.addgene.org/81071/
SV40 sequencing primers not used or not disclosed17:
SV40pro-F, TATTTATGCAGAGGCCGAGG, SV40 promoter/origin, forward primer
SV40-spliceR, CACAAAGATCCGGACCAAAG, SV40 splice sequence, reverse primer
pBABE 3', ACCCTAACTGACACACATTCC (Weinberg Lab), SV40 enhancer, 3' of MCS in pBABE vectors, reverse primer
--------------
To understand the context:
Bio-BOMB, not “vaccine”, not “gene-therapy”
This 5th gen war, includes a war on semantics.
https://scientificprogress.substack.com/p/not-vaccine-not-gene-therapy-just
What do bioweapons have to do with the Department of Energy?
Anybody answering these questions PLEASE ? !!!
https://scientificprogress.substack.com/p/what-do-bioweapons-have-to-do-with
Blindly obeying orders to the point of suicide?
From cannon fodder to haccine fodder: soldiers as collateral damage in the DoD jihad against "bugs".
https://scientificprogress.substack.com/p/testimony-from-the-military
You are an anti-haxxer!
https://scientificprogress.substack.com/p/you-are-anti-haccine
Who are The Powers That SHOULDN'T Be ?
https://scientificprogress.substack.com/p/criminal-intent
https://www.coreysdigs.com/global/who-is-they/
Weaponization of Justice
https://scientificprogress.substack.com/p/weaponization-of-justice
Illuminati David Rockefeller, finest quotes:
https://scientificprogress.substack.com/p/david-rockefeller-illuminati
Illuminati Attali, finest quotes:
https://scientificprogress.substack.com/p/attali-illuminati-finest-quotes
Confessions of ex illuminati Ronald Bernard:
https://scientificprogress.substack.com/p/confessions-of-illuminati-ronald
The way out of this mess:
The full PLAN exposed:
https://scientificprogress.substack.com/p/the-plan-revealed
16 laws we need to exit Prison Planet
https://scientificprogress.substack.com/p/laws-to-exit-planet-prison
President John Quincy Adams: “Masonry ought forever to be abolished. It is wrong - essentially wrong - a seed of evil, which can never produce any good.”
If you are a mason or know a mason, ask him to ask his 33° master to put in writing and sign it, that Lucifere is not "the great architect" (then who?). If he refuses, then he’ll know he is serving Satan: tell him to get out of masonry NOW.
Ex mason Serge Abad-Gallardo:
https://www.ncregister.com/interview/confessions-of-a-former-freemason-officer-converted-to-catholicism
https://rumble.com/v294ksc-words-from-33rd-degree-master-mason-rare-video-masons-worship-all-sorts-of-.html
https://odysee.com/@HiddenTruths:c/Masonry's-Satanic-Connection:4
https://rumble.com/v2wg24a-masonrys-satanic-doctrine-from-their-own-books.html
https://odysee.com/@John_4-14:a/Do-Freemasons-Worship-Lucifer%EF%BC%9F-Evidence-They-Don't-Want-You-To-See-%EF%BD%9C-Hidden-Agendas---Walter-Veith:0
https://odysee.com/@thisworldworks:1/satanic-ritual-abuse-and-secret-societies-1995:3
https://odysee.com/@Gmail.com:52/822821884_Satanic-Pedophilia-Torture-and-Blood---Dark-Satanic-Secrets-Revealed:4
https://rumble.com/vs9mxb-heres-why-christianity-is-totally-incapatable-with-freemasonry.html
Almost all anti-viral vaccines and all COVID vaccines were abortion-linked (using cell lines from aborted babies, i.e. butchered-alive delivered babies). Abortion is one type of ritual murder: Satan’s most wanted human sacrifice. Abortion-laced vaccines have the same effect of hexxed food: sharing in the Satanic chalice of blood, just the same as when they drink the blood of their children/virgin/human victims in their ritual murders.
OK. Just WOW😬
Yep I read it ALL
I applaud your knowledge expertise research and writing skill
am debating whether to read it again
the Masonry tie-in is disquieting
Sincerely
Prof Nazar, which New England Journal of Medicine article was the above quotes from please? This one?
https://www.nejm.org/doi/full/10.1056/NEJMoa2405541
He still props up germ theory and vaccinology. These intentionally overcomplicated topics distract people from rejecting the entire false paradigm of vaccinology. Pharma fascism continues.
So far I have only read the first few paragraphs and have to stop to take a break because the information revealed is so disturbing.
I know
J J Couey has been enthusiastically warning about transfection.
He taught me the meaning of the term.
This post will be a bit much, for those suffering from cancer, to read.
I am not at all surprised - or disturbed by these revelations.
Why Don’t They Discourage Bad Dietary Choices and Stop Vaccinating?
Consider the impacts on the economy of not reducing the life spans of humans.
Let’s say 30% of the population of a country lived beyond 90 years. Pension plans would implode as there would not be enough money to cover redemptions. For those on public pensions, we could raise taxes to ensure pensioners get paid, but that would mean less money for schools, roads and other infrastructure. Government services would need to be dramatically scaled back resulting in huge job losses.
All of these elderly people would essentially be ‘useless eaters’ sapping the economic strength of the country to provide them with medical care and free bus passes, while they produce and contribute nothing.
Why did they ramp up the vaccine schedule in the 80’s? I would suggest that they did this because population (which grows exponentially) was about to get out of control so they needed to take action. What would our overall population be if not for the vaccine push and the dramatic increase in the availability of processed foods in recent decades?
You are Expendable
At the end of the day all they care about is having enough circus and barnyard animals to operate the farm. They could care less about you or your health - you are EXPENDABLE.
They most certainly do not want one third of the population living to 90+ Japan and China are prime examples of what happens when a country is top heavy on elderly citizens. Too few young people to support the elderly.
Without these wise decisions by the Men Who Run the World to deploy strategies to cull the herd, the global economy would have collapsed years ago under the dead weight of too many geriatrics.
https://fasteddynz.substack.com/p/vaccines-are-population-control
Your real face is showing, slow eddy
Beyond disturbing.
Am I getting the message right - that not all polio vaccines were/are contaminated with simian monkey cells?
Polio vaccination in India is a sorry tale with or without contamination. The classic vaccine industry playbook:
1) pre-vaccine, draw the definition of the disease as widely as possible to bump up the apparent threat
2) introduce vaccine and redefine the problem much more narrowly to exclude many or most instances that would previously have been counted as the disease
3) establish a new category of disease to capture vaccinated individuals who stubbornly continue to show the symptoms of the original disease or any new symptoms that might arise.
Hey presto, polio is cured by vaccines.
In the case of polio in India (where the guinea-pigs got up to 10 separate shots), they call the new category non polio acute flaccid paralysis. It just happens to have the same symptoms as polio acute flaccid paralysis, but obviously can’t be because…… well, vaccines of course have eradicated the polio version.
And the Indian government let it go because of the other inducements given by the various aid agencies, WHO etc. It’s beyond wicked.
All you need to know is that all vaccines are bullshit. If we just got people to that point, we wouldn’t have to sit here and speculate on which poisons are in which vials.
You are quite right.
But I'm unfortunately still fascinated by what's in them.
We still don't know what the COVID is nor everything that's in the vaccines.
Those who have had the vaccines dont want to know.
Whole cells, I don't know if it was that sloppy. Possible. But 100% sure they were all contaminated with cell proteins.
Excellent although of course frightening article, thanks
Hi Doctor! I would like to send your piece regarding the discovery of undeclared 'contamination of injections (plasmids) found in mRNA Covid injections' to my local medical centre with whom I'm having a running dispute regarding my repetitive updates on the dangers of poisonous, unsafe, unproven 'experimental' injections known as 'mRNA Vaccines'.
They have warned me off so I now send just one email each week with three important topics for them to realise the inherent dangers of mRNA injections and of what has been going on since the Covid jabs were introduced back in 2020.
Thanks! Unjabbed Mick (UK).
Could I suggest that you are wasting your time? You might be better setting up a stall outside the practice with a bunch of papers that show what you are trying to show. People would be very interested. Look up Steven Crowder.
Thanks Doctor!
I understand your suggestion that I might be 'banging my head on a brick wall', but at 79, I'm not easily able to get involved in such activities. My hope is that some of the many recipients I copy in on these important (hidden) emailed issues, there will be some of the medical staff who might have the inclination to be inquisitive. They will see that some of the suggestion could be true as they emanate from experts and professionals. I also copy in my local politicians, the media and other derivative organisations like the Vax Control Group, who have been recording and analysing vax related issues for over 3 years now.
Not only that, I feel better hoping that some of my emails might stimulate those with an enquiring mind. Even if it's only a 'receptionist' or 'clerk' working in the medical environment.
Nearly three years ago, I went for a preliminary hospital meeting to discuss a hip replacement with a nurse. I wore a tee-shirt with the message 'Covid Unvaxxed Club' on. The nurse was relieved to reveal that she did not want the jab and that her job was at risk for refusing it. So there are many who might be 'on the fence' or feeling alone in their belief that they are being unreasonable to refuse poisonous mRNA being jabbed into their bodies. It's my small token to let people know they are not alone and that it can be sensible to think outside the box!
We all have our own methods of expressing our beliefs. some of which might be a waste of time, but at least we feel better for making an effort to be heard!
Best regards! Unjabbed Mick (UK).
Did you get the hip replacement, Mick? If so, read this https://www.telegraph.co.uk/news/2024/10/16/nhs-cobalt-hip-replacement-modular-neck-poison-chrome/
Yup! 3 weeks after a hernia operation - in the same hospital, with whom I'm in dispute regarding my historic bombardment of emailed evidence regarding mRNA Vax Dangers, Big Pharma's insistence on Zero LIABILITY and other controversial matters.
Both ops went well, I wore my 'UK Covid Unvaxxed Club' tee-shirt during the hip op and a 'Don't mention IVERMECTIN" tee-shirt during the hernia operation. The medical staff seemed to accept my unreasonable thought processes without comment or criticism!
Since the operations, I find myself in conflict with both my local medical centre and the Hospital Administration, who I didn't realise were part of a Medical Group. I'm not sure they realise I've been a patient twice over the past 3 months, but I've got a physio appointment nest week when I'll make myself known to the Admin Dept to see if they want to discuss any of the FACTS and DATA that I've been sending, which they claim is 'unwanted'.
On the matter of other Hip operations with 'complications' I seem to have avoided such issues. The unfortunate lady that seems to have had her life altered by a Hip-op seems to have had a problem with a 'cobalt' type product. I can only imagine that cobalt isn't as durable as titanium and ceramic, which I am told is the type used on me. I just hope the hip stands up to me getting back into cage fighting. (Only kidding). Unjabbed Mick.
If anyone is serious about this ... they should be organizing shifts of people to stand outside medical clinics holding up signs:
Vaccines Cause Cancer
That's the problem! Coordinating our actions. I think we need a website to achieve this.
Can anyone help in this important issue? If we could access one site that shows what activities and events are taking place, what actions others are taking and the success of these actions, we can get recognition of the truth about what has become apparent since 2019.
Great topic Fast Eddie!
Unjabbed Mick (UK). Together we can win - divided we struggle for acceptance and acknowledgement!
There is a website ... it's called Substack ... it is doing a wonderful job ensuring nobody does anything... https://fasteddynz.substack.com/p/substack-a-ministry-of-truth-production
I have difficulty crediting people who refer to vaccinations as jabs. It puts you in the category of MAGA crazies.
They are NOT "vaccinations" as they do not prevent illness. They, in fact, CAUSE illness.
Do you prefer "injection" to the term "jab"?
"Jabs" is a great term for the administration of the pseudovaccines. I wonder if Deborah just said what she did to virtue signal but actually is voting for Trump. I wouldn't be surprised if she got her perspective from her husband who in turn picked it up from meetings of "White Dudes for Harris."
: )
I agree about the term "jabs." I actually think I picked up its use from your "Against the Jab" profile motto and started using it quite a while ago rather than type out "injection." And because it seems to more precisely allude to the violence of pseudovaccination with a boxing metaphor.
Yes it's a good metaphor. Did you hear what President Trump said at the Al Smith dinner?
Yes, I did! Wish I'd seen it live but I read a very detailed article (maybe in the NY Post?) that reported at least half a dozen or more very clever and pointed barbs against Harris and the Dems. I don't think anyone else could have delivered the same "jokes" with the same effect as Trump. It really is all in the delivery.
I have difficulty crediting people who refer to other people as "MAGA crazies". It puts you in the category of propagandised.
Yes but if your husband is a member of "White Dudes for Harris" ...
If it quacks like a duck....
Deborah! Had you bothered to investigate you'd have realised by now that those of us who have studied what has been going on in the medical and pharmaceutical world, know that 'VACCINES' (Pre-2010) included attenuated material from the disease or virus it was supposed to counteract! Several years ago, 'they' (conveniently) changed the dictionary to suit mRNA DEADLY UNPROVEN JABS to be included in the meaning of VACCINE.
That's why the educated amongst us try to avoid using the word VACCINE for mRNA injections (JABS) which have been modified to suit Big Pharma's mercenary greed and voracity for control.
Unjabbed Mick (We'll live longer if we can avoid CORRUPT pharmaceutical murders.
I don't need to study anything to know that a jab is an intentionally derogatory term. Scientists don't use that term. So when you do, your message is less believable.
Broaden your mind! Mick.
These vaccine manufacturers wouldn’t have a financial reason to CAUSE cancer recklessly or deliberately, would they? Such as some other, very expensive, products they might seek to sell cancer patients, would they? That would be a massive conflict of interest, which surely the - independent and certainly not conflicted - regulators would immediately spot and address, isn’t it?
Great article: clear, easy to follow and deeply disturbing.
The main reason is not financial... https://fasteddynz.substack.com/p/vaccines-are-population-control
It can be argued as to which motivation is primary, but I think that it would be more accurate to consider the points as short and long-term goals. Making scandalous profits on the way to cutting population levels and subverting the sanctity of human souls is a logical step.
100% agree.
WOW, just wow! Thank you for this brilliant yet frightening piece and reference materials. I will share with many, but sadly, if I share these things with my jabbed family and my sons, it will only drive a bigger wedge. They won't entertain anything contrary to the narrative they've been fed by the media. They will not even read something that might save their lives. I'm just a tin foil hat wearer, who spreads conspiracy theory. My 88yr old Mother just got her flu shot last week, she wouldn't listen to me. Surely the rest of my family will too. 😴😪 🙏🙏
I find the best way of managing this situation is to encourage them to get all the products recommended.
I might as well try that. At this point they're already poisoned, and if they stop taking shots, because of me, and get sick, well... we know who will get blamed. Can't win for losing.
I work in healthcare and this reminded me of a patient we lost last week - a man loyally and fiercely loved by his devoted family who only wanted to look after him, but who deeply believed every word every doctor had ever spoken.
He died last week, having developed multiple large tumours - 2 in his chest (which the oncologist described as "beginning to split apart"), pressure on his heart and lungs making it difficult to breathe, another mass pressing on his bladder causing incontinence, and legs so heavy and swollen with oedema and fluid "soaking through bandages" that he was confined to a wheelchair.
This was such a miserable existence that he was in the process of initiating "Assisted Dying" pathways, but not before the family agreed to yet another procedure - an endoscopy which inadvertently perforated his bladder and killed him last week.
He'd gone from independent, fit and healthy, walking and cycling daily, and maintaining a large garden - to 17 different vaccinations in a 2 year period, and being loved to death.
GOD rest his soul, and have mercy on his family. So sad. GOD bless you, you will need great strength for the coming, most likely, monsoon of these types of occurrences.
YES!!!
https://fasteddynz.substack.com/p/there-is-no-cure-for-stupidity
That would shock them indeed, to be told that by someone whom they are accustomed to eye rolling at.
LOL
Governments and regulatory bodies are providing a self service not a public service. One of the jobs they were charged with was to be gatekeepers between the population and predatory agencies to provide protection, instead they have offered us to them on a silver platter while receiving rewards for their treachery. We all heard the awful slogan Build Back Better during Covid well our governments, public health, regulatory bodies and institutions need to listen to their ow propaganda and be built back better. This article horrifies me and outstrips any fictional horror story I know of. Most of us are not free from these dangers, I did not take Covid injections but I received others pre 2020.
"Governments and regulatory bodies are providing a self service not a public service. One of the jobs they were charged with was to be gatekeepers between the population and predatory agencies to provide protection, instead they have offered us to them on a silver platter while receiving rewards for their treachery"
Extremely Well Said. Thank you Amat.
Once again, great article, but also petrifying.
So every baby that is born is transfected?
Isn’t HepB vaccine is given to newborns, at least in the U.S.?
Giving a vaccine against a virus that is only transmitted sexually or IV drug use to a baby asks a lot of questions of the people looking after the baby
U may find this interesting, as a gyn , I had a patient with high grade Vain (she had hysterectomy yrs ago and has vaginal warts , age 61) . Sent her to a gyn onc who asked me to give her a rx for guardasil shot at the local cvs. I was dumbfounded and said no .
She is lucky to have you looking after her !
Thank u but Seriously who would give her that jab .
Sadly, Integrity is a scarcity these days.
As a mother who didn't do the proper research and allowed her children to be vaccinated against HepB, reading that comment makes my heart ache and brings tears to my eyes. I appreciate this brilliant work that you have shared. Thankfully, I found Dr. David Martin and Dr. Judy Mikovits early in the pandemic, have been keeping up w/ the work of Kevin McKernan, and listen to podcasts w/ Dr. Jack Kruse. When my children were born, I (unfortunately) blindly trusted the pediatrician. Deferred Hep B and other shots for second child at birth, then did what I was told was safe and effective: took her for her well visit at 2 months where she received five shots(!), one which was Hep B. After that visit, she developed an unknown (this is not eczema! said the pediatrician) autoimmune skin condition. I count my blessings that I found a holistic nutritionist who used applied kinesiology to work with my daughter at 6 months; I was giving her fish oil and probiotics from that point forward. I continued with the "schedule" for 16 more months, then after she had a reaction to the DTaP at 18 mo, I finally woke up. Six months later, we moved and saw the head pediatric dermatologist at Hopkins - he told me he sees this everyday (!), slapped a label on it, and told me she'd need to take an antihistamine for the next 10 years, that I just needed to find the dose that didn't make her dopey. I promptly found an integrative physician and we found another way (quercetin!) and we have been on a journey ever since. Her life has been full of health challenges and after reading all the vaccine package inserts, especially what appears in the post marketing adverse events section, I am pretty confident the root cause of many of the things she faces is the shots. I realize the damage could have been far worse, as she does not have autism and wishes to pursue a career in medicine. In fall of 2020, I was researching excipients and adjuvants, looking at the CDC's tables, pondering the impact of these chemicals and especially curious about the HEK293 cells. I knew about aluminum and Dr. Exley's lab. And now I know more, thanks to your work. It's so much to take in, especially for one who did not study medicine. I recently heard Dr. Jack Kruse say "wounds create your wisdom" -because of her wounds, we knew not to get anywhere near the covid shots. Thank you for this important information.
They can test mothers prior to delivery so there is really no excuse but the one they give is that hepatitis b could be acquired through close household or daycare contacts-blood, fecal exposure, using or chewing on an infected person’s toothbrush. I would like to know of the documented cases of any of these things that have happened. Have read that after a few years the immunity is gone unlike when it is given later. I know mine was still showing up in blood work more than 20 years after I had hepatitis b vaccine when working at a clinic. It is insanity to inject all newborns with anything I took no medication of any sort during my pregnancies. Why would I want my child immediately assaulted with something unnecessary for almost a hundred percent of American infants
Exactly. If the mother is negative then the family is negative and you don’t get hepatitis B from toothbrushes. And, not wanting to state the obvious but babies don’t actually have teeth.
This does need calling out. If someone wants to give your newborn baby a hepatitis B vaccine, ask why. If they say that they can get hepatitis B in the hospital, get out of that hospital.
There was no reason for my children to be vaccinated for HepB. Zero risk. Massive guilt for not knowing better/researching.
It’s a wonder any of us are still alive. No wonder cancer rates are soaring!
Just had another friend drop dead yesterday... turbo stomach and lung cancer... less than 6 months from first symptoms to death. And during that time he was pumped full of chemo so suffered horribly
So sad. An aquaintance of mine, who still thinks the shots are great and continues to get boosters, said the other day she knows 6 people (in her small rural town) with pancreatic cancer ... 6! I thought it used to be pretty rare, but not nowadays.
They must be the same six that I know of…
Redacted docs = knowingly withheld = fraud, right?
That's my view
Arkmedic—when a Substack article shows up in my inbox from you i know its going to blow my mind. You never disappoint.
The problem is still this though—the media will ignore this new info, they will mock anyone talking about it and in 6 months the covid vaccines will still be on the childhood schedule.
Thank you for all you do, youre a hero.
How fortuitous that Pfizer recently overpaid by 30 something Billion $ for a cancer treatment company. Just a lucky business move. Riiiiight?
Wow. I think I might invest in that company. Sounds reaalllllyyyy profitable. So despicable how these companies with profit from the diseases they create.
A thought... Is it possible that a further introduction of SV40 is igniting and accelerating that 40 year time bomb from the polio vaccine?
Yes, all these things are possible. Unfortunately
Well, there you go then.
That fcuk-wit that used to be head of the TGA (as well as everyone else that worked there) has a bit of explaining to do ... before all of his assets are confiscated to help pay restitution.
Thank you for this article and for tieing ask this data together. Fascinating stuff and I really hope the work you are doing receives the exposure it deserves. Do you know Dr Christopher Exley? He has been investigating the role of aluminium as as adjudicant in vaccines for several years. It's his life work I think. He's on Substack.
He wrote about AAHS here
https://open.substack.com/pub/drchristopherexley/p/aluminium-aluminum-hydroxyphosphate?r=peo1w&utm_medium=ios
Dear Dr. Ah,
The thing that hit me, decades ago, when I first dug into the "science" and language surrounding those toxic injections labeled "vaccines," (which almost killed my four year old little girl, back in 1999,) was the oh-so-innocent sounding term "adjuvant." "Nice name you have there, what does it mean, actually?"
Well, something added to a vaccine to make it work better! What kind of something? How DOES it "help the vaccine to work better?!" And, guess what? Killed virus vaccines don't work without them. Hmm.
So, in my experience, adjuvant is a "cover label" for TOXIN. Something stunningly toxic in fact, that gets injected with the killed virus to shock the immune system into making antibodies against a dead viral particle, which otherwise it will not do. It's an assault on the human immune system that in my lay person's terms, gives many children's immune systems "PTSD" in the form of allergies, asthma, autoimmunity, etc., and the inflammation from the injection of these poisons does long term brain damage as well, in many cases.
But, here is the point now, after this recent discovery that these adjuvants are not simply highly toxic substances but actual transfection devices destroying cellular integrity & driving Foriegn genetic material into our cells which then can "hack" or possible combine with our DNA.
Wowsa. Now I know why so many of my female friends never fully recovered post Gardasil. It not just the toxin it's the DNA damage, and why so many women in the USA are infertile, why cancer is skyrocketing, why Autoimmunity of all sorts, and intellectual disabilities are soaring. Why we are the sickest industrialized nation on Earth.
Arkmedic, Humanity is under attack. Behind this very nefarious agenda is an evil intelligence which must thrive on human pain and suffering. I can come to no other conclusion, after witnessing the toxic injectable assault on all of America's children, especially since the 1980s.
Everyone must face this eventually, imho, who is seeking the truth here. We are being GMOed, and not to make us better, but to make us sicker, dumber & infertile.
To turn us into slaves in fact, unable to resist the yoke or to fight back, stripped of our Freedoms & our Property, as well as our Health.
It's time to reject all toxic or genetic shots, to go after ALL of the perps on fraud, murder, RICO, & more. The public & it's honest representatives must wake up & take this on as some brave Australians have just done. Push more, push harder, and never give up!
"To the winner go the spoils," & in this case the "spoils" are simply LIFE.
God gave it to us, so let no man, woman or "devil" steal it from us, yes?!